version
PlantPromoterDB promoter information of J013099D16

Summary of Gene (J013099D16)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0736500        NCBI 
Gene model J013099D16  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 31643664-31642465)

Genome position     
from initiation codon
011-047-F01         
AK065166            
J013002C12          
J013026J23          
J013106L03          
J033037H10          
J043035O11          
J043040A13          
J065086O04          
J065129L18          
J075029M15          
J075043N20          
J075058E08          
J075068J06          
J075072G10          
J075076F20          
J075114G19          
J075141K22          
J075144K04          
J075170E03          
J075195O11          
J090009D06          
J090042C23          
J090058I04          
TSS from cDNA
TSS information
J013099D16                       5'->3' (-)
Promoter sequence








 
AK121498            
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013099D16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-31643373-709

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCC-3164332731643334-663-670
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAGGCCCATAAAAGCCCAAC-3164341831643437-754-773
 OsREG430AAGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA           PPDB MotifGCCCA  PLACE Motif 
 OsREG605   GCCCATAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG419         AAAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG421          AAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG426           AAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG458            AGCCCAAC PPDB MotifGCCCA, CCAACGG  PLACE Motif 
REGTAATGGGCCGAA-3164344331643454-779-790
 OsREG610TAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG642    GGGCCGAA PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCCGGGC-3164346931643481-805-817
 OsREG593GTTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG   PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG614     GGCCGGGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.