version
PlantPromoterDB promoter information of J013100P18

Summary of Gene (J013100P18)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0227800        NCBI 
Gene model J013100P18  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 6781040-6782239)

Genome position     
from initiation codon
013-020-B05         
016-033-F09         
AK061960            
AK063571            
AK103846            
J013028J20          
J013091I04          
J013128L15          
J013153M09          
J033072J03          
J033074L07          
J033106H15          
J033148J22          
J043024D23          
J065005B02          
J065009M20          
J065035E23          
J065039E24          
J065057P20          
J065066E10          
J065072G21          
J065076N07          
J065093G14          
J065127K10          
J065142O20          
J065165O18          
J065179O07          
J065203E15          
J080305J16          
J080311E04          
J090008C14          
J090083E01          
J090092B02          
J090098O14          
J100042A12          
J100090K14          
TSS from cDNA
TSS information
J013100P18                       5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013100P18

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+6781611-429
TSS clone peakAclone+6781618-422

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCTCT+67815906781597-450-443
Y PatchTCTCCTCCTCCC+67816516781662-389-378
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCGTCGC+67813396781346-701-694
 OsREG559CGCGTCGC PPDB Motif  PLACE MotifCGACG 
REGCGCCACGTG+67815046781512-536-528
 OsREG448CGCCACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507 GCCACGTG PPDB MotifACGT  PLACE MotifACGTGKC 
REGGGCCGTCCGA+67815246781533-516-507
 OsREG624GGCCGTCC   PPDB Motif  PLACE Motif 
 OsREG562 GCCGTCCG  PPDB Motif  PLACE Motif 
 OsREG545  CCGTCCGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGCGTGGA+67820796782086J013091I04, J080305J16
 OsREG636GGCGTGGA PPDB Motif  PLACE Motif 
REGGGGCGAGG+67820976782104J013091I04, J080305J16
 OsREG549GGGCGAGG PPDB MotifGCCCA  PLACE Motif 
REGCTCGCGCG+67821446782151J013091I04, J080305J16
 OsREG558CTCGCGCG PPDB MotifACGCGC  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.