version
PlantPromoterDB promoter information of J013104C07

Summary of Gene (J013104C07)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0813400        NCBI 
Gene model J013104C07  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 36334637-36335836)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J013104C07                       5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013104C07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+36336188-699
TSS clone peakAclone+36336190-697

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCAGCTATAT+3633615436336162-733-725
Y PatchTCTCTCCCCC+3633614536336154-742-733
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTTGGGCTGGGCCGGG+3633590336335919-984-968
 OsREG594TGTTGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG458 GTTGGGCT         PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG511  TTGGGCTG        PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG533    GGGCTGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG603     GGCTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG620      GCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565       CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542        TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG538         GGGCCGGG PPDB MotifGCCCA  PLACE Motif 
REGCATCCACCAGCCCAAA+3633594036335955-947-932
 OsREG515CATCCACC         PPDB Motif  PLACE Motif 
 OsREG523      CCAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG511       CAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG457        AGCCCAAA PPDB MotifGCCCA  PLACE Motif 
REGATCGGACGGAC+3633607636336086-811-801
 OsREG484ATCGGACG    PPDB Motif  PLACE Motif 
 OsREG545 TCGGACGG   PPDB Motif  PLACE Motif 
 OsREG561  CGGACGGA  PPDB Motif  PLACE Motif 
 OsREG623   GGACGGAC PPDB Motif  PLACE Motif 
REGCCACGCGTGCG+3633610536336115-782-772
 OsREG443CCACGCGT    PPDB Motif  PLACE Motif 
 OsREG555   CGCGTGCG PPDB Motif  PLACE Motif 
REGGTGGTGGGGC+3633612936336138-758-749
 OsREG527GTGGTGGG   PPDB MotifGCCCA  PLACE Motif 
 OsREG612  GGTGGGGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.