version
PlantPromoterDB promoter information of J013108C14

Summary of Gene (J013108C14)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0227700        NCBI 
Gene model J013108C14  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 7780097-7778898)

Genome position     
from initiation codon
011-041-B09         
AK067567            
AK068760            
J013160I02          
J033093J12          
J065193C03          
J075108E17          
J075147K19          
J090039B13          
J100070O03          
TSS from cDNA
TSS information
J013108C14                       5'->3' (-)
Promoter sequence











 
AK110997            
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence











 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013108C14

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-7779375-278
TSS clone peakAclone-7779330-233

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCC-77793177779324-220-227
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAATTGGGCCGGCCCATTAGGTGGATGGGCCCACT-77794267779459-329-362
 OsREG433AATTGGGC                           PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC                          PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG                         PPDB MotifGCCCA  PLACE Motif 
 OsREG615    GGGCCGGCCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGGCCCA                    PPDB MotifGCCCA  PLACE Motif 
 OsREG490        CGGCCCAT                   PPDB MotifGCCCA  PLACE Motif 
 OsREG431         GGCCCATT                  PPDB MotifGCCCA  PLACE Motif 
 OsREG610          GCCCATTA                 PPDB MotifGCCCA  PLACE Motif 
 OsREG515                  GGTGGATG         PPDB Motif  PLACE Motif 
 OsREG534                    TGGATGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG608                     GGATGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG590                      GATGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489                       ATGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG640                         GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478                          GGCCCACT PPDB MotifGCCCA  PLACE Motif 
REGAGTTGGGCTTGGACCGGCCCGTT-77794637779485-366-388
 OsREG479AGTTGGGC                PPDB MotifGCCCA  PLACE Motif 
 OsREG458 GTTGGGCT               PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG426  TTGGGCTT              PPDB MotifGCCCA  PLACE Motif 
 OsREG496   TGGGCTTG             PPDB MotifGCCCA  PLACE Motif 
 OsREG519    GGGCTTGG            PPDB MotifGCCCA  PLACE Motif 
 OsREG440            ACCGGCCC    PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG424               GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGGGCCGGGCC-77796197779627-522-530
 OsREG614GGCCGGGC  PPDB Motif  PLACE Motif 
 OsREG616 GCCGGGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+7779524AK110997, AK110997

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGGCCGGA+77792617779268AK110997
 OsREG644GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGAGTGGGCCCATCCACCTAATGGGCCGGCCCAATT+77794267779459AK110997
 OsREG478AGTGGGCC                           PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC                          PPDB MotifGCCCA  PLACE Motif 
 OsREG489   GGGCCCAT                        PPDB MotifGCCCA  PLACE Motif 
 OsREG590    GGCCCATC                       PPDB MotifGCCCA  PLACE Motif 
 OsREG608     GCCCATCC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG534      CCCATCCA                     PPDB MotifGCCCA  PLACE Motif 
 OsREG515        CATCCACC                   PPDB Motif  PLACE Motif 
 OsREG610                TAATGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG431                 AATGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG490                  ATGGGCCG         PPDB MotifGCCCA  PLACE Motif 
 OsREG615                    GGGCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542                   TGGGCCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563                        CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492                         GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433                          GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGAACGGGCCGGTCCAAGCCCAA+77794637779483AK110997
 OsREG424AACGGGCC              PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
 OsREG440   GGGCCGGT           PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG519           CCAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG496            CAAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG426             AAGCCCAA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.