version
PlantPromoterDB promoter information of J013108H11

Summary of Gene (J013108H11)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0498600        NCBI 
Gene model J013108H11  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 25314205-25315404)

Genome position     
from initiation codon
003-111-F09         
006-043-G10         
011-053-C04         
013-060-C07         
015-093-H02         
AF067194            
AK067166            
AK072162            
AK098918            
AK100589            
AY966487            
J013002M21          
J013032O08          
J013036P09          
J013040A18          
J013040P15          
J013047I24          
J013057K23          
J013071K06          
J013075N17          
J013100C20          
J013102K20          
J013119H18          
J013119L16          
J013129E09          
J013129L10          
J013130H09          
J013134O22          
J013151B03          
J013155M19          
J013170N11          
J023001A10          
J023002F19          
J023010D08          
J023030D04          
J023031A05          
J023031O21          
J023050E10          
J023056D09          
J023061G22          
J023065G21          
J023074B22          
J023081I24          
J023083D15          
J023087D24          
J023090E11          
J023090F06          
J023110L19          
J023114A05          
J023114J23          
J023119G18          
J023127G22          
J023141J20          
J023141L13          
J033023I11          
J033025D01          
J033034C13          
J033035A16          
J033038J19          
J033040E15          
J033040H12          
J033042L22          
J033043O13          
J033044I04          
J033045D07          
J033057O15          
J033073D07          
J033086E09          
J033086H13          
J033086H21          
J033086K18          
J033091I22          
J033091J02          
J033098F12          
J033099H08          
J033107E22          
J033116H15          
J033119M02          
J033124G16          
J033131C06          
J033147D18          
J043016N12          
J043026E15          
J043040M19          
J053053H11          
J065069O17          
J065081E10          
J065105B13          
J090016O15          
J090023F20          
J090028D20          
J090028M24          
J090038B19          
J090038O08          
J090042P20          
J090049M13          
J090056J04          
J090060I19          
J090062M17          
J090071E22          
J090072P06          
J090080F18          
J090095I01          
J090098F02          
J100025G12          
J100029M21          
J100034L23          
J100043I19          
J100078N20          
J100080K04          
J100090G16          
J100090P06          
Y07766              
TSS from cDNA
TSS information
J013108H11                       5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013108H11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCTCCCCCA+2531523025315237006-068-G08, 006-095-H08, 006-108-E12, 009-194-E05, AK062001
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 
REGCACCTGTC+2531529625315303006-068-G08, 006-095-H08, 006-108-E12, 009-194-E05, AK062001
 OsREG501CACCTGTC PPDB Motif  PLACE Motif 
REGAGGGCCCAGAT+2531534325315353006-068-G08, 006-095-H08, 006-108-E12, 009-194-E05, AK062001
 OsREG475AGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG579 GGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG486   GCCCAGAT PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.