version
PlantPromoterDB promoter information of J013126J24

Summary of Gene (J013126J24)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0678500        NCBI 
Gene model J013126J24  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 29678103-29676904)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J013126J24                       5'->3' (-)
Promoter sequence



 
J065207L21          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013126J24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-29676795-142

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTCGCGTC-2967695929676966-306-313
 OsREG583GTCGCGTC PPDB Motif  PLACE Motif 
REGGCCCAAAC-2967703929677046-386-393
 OsREG593GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGTTGGCCCAAC-2967706029677069-407-416
 OsREG660TTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG626  GGCCCAAC PPDB MotifGCCCA, CCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCTCGGCCCAGC+2967802829678038009-114-H06, AK063019, AK071536, AK120629, J013045E23, J013153D21, J013157A14, J023048M04, J065006P11, J065042O14, J065080D15, J065096M02, J065109M14, J065204H02, J065207L21, J075028D22, J075040O12, J075051O03, J075071M13, J075151H15, J075153D16, J075153I21, J080311L16, J100053A20, J100071P19
 OsREG575CTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620   GGCCCAGC PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.