version
PlantPromoterDB promoter information of J013127E01

Summary of Gene (J013127E01)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0168200        NCBI 
Gene model J013127E01  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 3276164-3277363)

Genome position     
from initiation codon
J065059G22          
J065112D22          
J065171G04          
J065203N24          
J075013P03          
J075015L20          
J075088I20          
J075174A20          
J075175B05          
J075177B11          
J075189C14          
J075190O20          
J075192G09          
TSS from cDNA
TSS information
J013127E01                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013127E01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTTTATAAGCG+32773523277363005-010-H01, 009-156-F07, 012-025-F01, 012-089-A02, 016-016-E08, AK073392, AK099225, AK101469, AY236158, J013152M22, J023013N11, J023038J11, J023054N21, J033041E13, J033050O09, J033093G05, J033094J17, J033112J24, J033113D05, J033120K10, J033121H19, J033129C08, J033140H24, J065020I18, J065058L01, J065059G22, J065212L09, J075047P09, J075063C18, J075076E07, J075077F14, J075086C22, J075161L09, J075177K20, J090007L06, J090010M02, J090013M20, J090044I15, J090045O06, J090060L04, J090061C17, J090062F10, J090066L03, J090089E13, J090096D21, J100039F12, J100053N06
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTGTGGGCCAGAGCCCATCC+32772343277253005-010-H01, 009-156-F07, 012-025-F01, 012-089-A02, 016-016-E08, AK073392, AK099225, AK101469, AY236158, J013152M22, J023013N11, J023038J11, J023054N21, J033041E13, J033050O09, J033093G05, J033094J17, J033112J24, J033113D05, J033120K10, J033121H19, J033129C08, J033140H24, J065020I18, J065058L01, J065059G22, J065212L09, J075047P09, J075063C18, J075076E07, J075077F14, J075086C22, J075161L09, J075177K20, J090007L06, J090010M02, J090013M20, J090044I15, J090045O06, J090060L04, J090061C17, J090062F10, J090066L03, J090089E13, J090096D21, J100039F12, J100053N06
 OsREG597TTGTGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG627 TGTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG654  GTGGGCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG          PPDB MotifGCCCA  PLACE Motif 
 OsREG638    GGGCCAGA         PPDB MotifGCCCA  PLACE Motif 
 OsREG466           AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG608            GCCCATCC PPDB MotifGCCCA  PLACE Motif 
REGCCCAGCCCAGCCCAG+32772573277271005-010-H01, 009-156-F07, 012-025-F01, 012-089-A02, 016-016-E08, AK073392, AK099225, AK101469, AY236158, J013152M22, J023013N11, J023038J11, J023054N21, J033041E13, J033050O09, J033093G05, J033094J17, J033112J24, J033113D05, J033120K10, J033121H19, J033129C08, J033140H24, J065020I18, J065058L01, J065059G22, J065212L09, J075047P09, J075063C18, J075076E07, J075077F14, J075086C22, J075161L09, J075177K20, J090007L06, J090010M02, J090013M20, J090044I15, J090045O06, J090060L04, J090061C17, J090062F10, J090066L03, J090089E13, J090096D21, J100039F12, J100053N06
 OsREG533CCCAGCCCAGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG523 CCAGCCCAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG512  CAGCCCAGCCCAG PPDB MotifGCCCA  PLACE Motif 
 OsREG464   AGCCCAGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG603    GCCCAGCC    PPDB MotifGCCCA  PLACE Motif 
REGTCCGTCCGA+32773153277323005-010-H01, 009-156-F07, 012-025-F01, 012-089-A02, 016-016-E08, AK073392, AK099225, AK101469, AY236158, J013152M22, J023013N11, J023038J11, J023054N21, J033041E13, J033050O09, J033093G05, J033094J17, J033112J24, J033113D05, J033120K10, J033121H19, J033129C08, J033140H24, J065020I18, J065058L01, J065059G22, J065212L09, J075047P09, J075063C18, J075076E07, J075077F14, J075086C22, J075161L09, J075177K20, J090007L06, J090010M02, J090013M20, J090044I15, J090045O06, J090060L04, J090061C17, J090062F10, J090066L03, J090089E13, J090096D21, J100039F12, J100053N06
 OsREG561TCCGTCCG  PPDB Motif  PLACE Motif 
 OsREG545 CCGTCCGA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.