PlantPromoterDB promoter information of J013127E01

Summary of Gene (J013127E01)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0168200        NCBI 
Gene model J013127E01  
Description NONE  


Focused view (chromosome 11: 3277164-3278363)

Genome position     
from initiation codon
TSS from cDNA
TSS information
J013127E01                       5'->3' (+)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


Promoter Summary of J013127E01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS cloneGclone+3277366AK073392, J065059G22, AK073392, J033041E13, J033129C08, AK101469, J023013N11, 016-016-E08, J033121H19, J033050O09, J090061C17, J033140H24, J033112J24, J023054N21, J090096D21, J090007L06, J023038J11, J065212L09, J100039F12, J090045O06, J090060L04, J100053N06, J090010M02, J090013M20, J090066L03, J033120K10, J013152M22, J033093G05, J090044I15, J090089E13, J090062F10, J075047P09, J075063C18, J075076E07, J075077F14, J075086C22, J075161L09, J075177K20, 009-156-F07, 012-089-A02, 012-025-F01, J033113D05, AK099225, J065020I18, J065058L01, J033094J17, 005-010-H01, AY236158
TSS clone peakGclone+3277383AK073392, J065059G22, AK073392, J033041E13, J033129C08, AK101469, J023013N11, 016-016-E08, J033121H19, J033050O09, J090061C17, J033140H24, J033112J24, J023054N21, J090096D21, J090007L06, J023038J11, J065212L09, J100039F12, J090045O06, J090060L04, J100053N06, J090010M02, J090013M20, J090066L03, J033120K10, J013152M22, J033093G05, J090044I15, J090089E13, J090062F10, J075047P09, J075063C18, J075076E07, J075077F14, J075086C22, J075161L09, J075177K20, 009-156-F07, 012-089-A02, 012-025-F01, J033113D05, AK099225, J065020I18, J065058L01, J033094J17, 005-010-H01, AY236158
TSS cloneAclone+3277405AK073392, J065059G22, AK073392, J033041E13, J033129C08, AK101469, J023013N11, 016-016-E08, J033121H19, J033050O09, J090061C17, J033140H24, J033112J24, J023054N21, J090096D21, J090007L06, J023038J11, J065212L09, J100039F12, J090045O06, J090060L04, J100053N06, J090010M02, J090013M20, J090066L03, J033120K10, J013152M22, J033093G05, J090044I15, J090089E13, J090062F10, J075047P09, J075063C18, J075076E07, J075077F14, J075086C22, J075161L09, J075177K20, 009-156-F07, 012-089-A02, 012-025-F01, J033113D05, AK099225, J065020I18, J065058L01, J033094J17, 005-010-H01, AY236158

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTTTATAAGCG+32773523277363005-010-H01, 009-156-F07, 012-025-F01, 012-089-A02, 016-016-E08, AK073392, AK099225, AK101469, AY236158, J013152M22, J023013N11, J023038J11, J023054N21, J033041E13, J033050O09, J033093G05, J033094J17, J033112J24, J033113D05, J033120K10, J033121H19, J033129C08, J033140H24, J065020I18, J065058L01, J065059G22, J065212L09, J075047P09, J075063C18, J075076E07, J075077F14, J075086C22, J075161L09, J075177K20, J090007L06, J090010M02, J090013M20, J090044I15, J090045O06, J090060L04, J090061C17, J090062F10, J090066L03, J090089E13, J090096D21, J100039F12, J100053N06
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
REGTTGTGGGCCAGAGCCCATCC+32772343277253005-010-H01, 009-156-F07, 012-025-F01, 012-089-A02, 016-016-E08, AK073392, AK099225, AK101469, AY236158, J013152M22, J023013N11, J023038J11, J023054N21, J033041E13, J033050O09, J033093G05, J033094J17, J033112J24, J033113D05, J033120K10, J033121H19, J033129C08, J033140H24, J065020I18, J065058L01, J065059G22, J065212L09, J075047P09, J075063C18, J075076E07, J075077F14, J075086C22, J075161L09, J075177K20, J090007L06, J090010M02, J090013M20, J090044I15, J090045O06, J090060L04, J090061C17, J090062F10, J090066L03, J090089E13, J090096D21, J100039F12, J100053N06
 OsREG597TTGTGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG627 TGTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG654  GTGGGCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG          PPDB MotifGCCCA  PLACE Motif 
 OsREG638    GGGCCAGA         PPDB MotifGCCCA  PLACE Motif 
 OsREG466           AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG608            GCCCATCC PPDB MotifGCCCA  PLACE Motif 
REGCCCAGCCCAGCCCAG+32772573277271005-010-H01, 009-156-F07, 012-025-F01, 012-089-A02, 016-016-E08, AK073392, AK099225, AK101469, AY236158, J013152M22, J023013N11, J023038J11, J023054N21, J033041E13, J033050O09, J033093G05, J033094J17, J033112J24, J033113D05, J033120K10, J033121H19, J033129C08, J033140H24, J065020I18, J065058L01, J065059G22, J065212L09, J075047P09, J075063C18, J075076E07, J075077F14, J075086C22, J075161L09, J075177K20, J090007L06, J090010M02, J090013M20, J090044I15, J090045O06, J090060L04, J090061C17, J090062F10, J090066L03, J090089E13, J090096D21, J100039F12, J100053N06
REGTCCGTCCGA+32773153277323005-010-H01, 009-156-F07, 012-025-F01, 012-089-A02, 016-016-E08, AK073392, AK099225, AK101469, AY236158, J013152M22, J023013N11, J023038J11, J023054N21, J033041E13, J033050O09, J033093G05, J033094J17, J033112J24, J033113D05, J033120K10, J033121H19, J033129C08, J033140H24, J065020I18, J065058L01, J065059G22, J065212L09, J075047P09, J075063C18, J075076E07, J075077F14, J075086C22, J075161L09, J075177K20, J090007L06, J090010M02, J090013M20, J090044I15, J090045O06, J090060L04, J090061C17, J090062F10, J090066L03, J090089E13, J090096D21, J100039F12, J100053N06

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.