version
PlantPromoterDB promoter information of J013130H17

Summary of Gene (J013130H17)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0557200        NCBI 
Gene model J013130H17  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 27793095-27794294)

Genome position     
from initiation codon
AK062090            
AK102111            
J013047E13          
J013089P04          
J013132C20          
J023001E06          
J023108C09          
J023125C12          
J033023O10          
J033033K16          
J033064C11          
J033071P07          
J033072H14          
J033084F06          
J033084H11          
J033097C05          
J033109A02          
J033136H18          
J043009E20          
J053035M10          
J053043J22          
J053082K10          
J053094N13          
TSS from cDNA
TSS information
J013130H17                       5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013130H17

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+27793978-117
TSS clone peakCclone+27794012-83

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAATTGGGCT+2779370027793708-395-387
 OsREG433AATTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG460 ATTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGAGGGCCCAAG+2779375127793760-344-335
 OsREG475AGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG639 GGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581  GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCTCGGCCCAACA+2779377727793794-318-301
 OsREG459CTTGGGCT           PPDB MotifGCCCA  PLACE Motif 
 OsREG575      CTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658       TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563        CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626         GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594          GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGGATCGGACGG+2779384127793850-254-245
 OsREG589GATCGGAC   PPDB Motif  PLACE Motif 
 OsREG484 ATCGGACG  PPDB Motif  PLACE Motif 
 OsREG545  TCGGACGG PPDB Motif  PLACE Motif 
REGCGTGTGGGGCCCACGCG+2779388827793904-207-191
 OsREG526CGTGTGGG          PPDB MotifGCCCA  PLACE Motif 
 OsREG535 GTGTGGGG         PPDB Motif  PLACE Motif 
 OsREG611  TGTGGGGC        PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC       PPDB Motif  PLACE Motif 
 OsREG641    TGGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647     GGGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG640      GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571       GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG602        GCCCACGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG530         CCCACGCG PPDB MotifGCCCA  PLACE Motif 
REGCACGCCAC+2779391827793925-177-170
 OsREG502CACGCCAC PPDB Motif  PLACE Motif 
REGCGCACGCG+2779393427793941-161-154
 OsREG555CGCACGCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.