version
PlantPromoterDB promoter information of J013134N08

Summary of Gene (J013134N08)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0764600        NCBI 
Gene model J013134N08  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 33946601-33945402)

Genome position     
from initiation codon
AK060621            
AK068053            
J013111L18          
J023082H23          
J033052J17          
J075167G18          
J075183B12          
J090078H06          
TSS from cDNA
TSS information
J013134N08                       5'->3' (-)
Promoter sequence








 
AK071863            
J023122I17          
J090089D06          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013134N08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-33945602-1

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGGCCCAGC-3394564733945657-46-56
 OsREG440ACCGGCCC    PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG542 CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620   GGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGTGATGGGCCGGA-3394567233945683-71-82
 OsREG607TGATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644    GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCCGAGA-3394571033945722-109-121
 OsREG593GTTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA   PPDB MotifGCCCA  PLACE Motif 
 OsREG575    GGGCCGAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG635     GGCCGAGA PPDB Motif  PLACE Motif 
REGCGGATCGGGCCGAG-3394572633945739-125-138
 OsREG541CGGATCGG       PPDB Motif  PLACE Motif 
 OsREG568     CGGGCCGA  PPDB MotifACGGGC  PLACE Motif 
 OsREG575      GGGCCGAG PPDB MotifGCCCA  PLACE Motif 
REGCGCGCGAC-3394583333945840-232-239
 OsREG557CGCGCGAC PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakTclone-33945598AK060621, J013111L18, AK060621

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.