version
PlantPromoterDB promoter information of J013146N16

Summary of Gene (J013146N16)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0897800        NCBI 
Gene model J013146N16  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 40791467-40790268)

Genome position     
from initiation codon
AF140489            
AK072409            
AK072812            
AK099099            
AY288943            
AY318757            
J013021C23          
J013027H03          
J013032C02          
J013068G13          
J013070K16          
J013070L02          
J013091E15          
J013109D04          
J013118B04          
J013129E08          
J013134I15          
J023083F05          
J023107E17          
J023113D21          
J023123A22          
J023133I24          
J023134L21          
J023142N24          
J033051B12          
J033058B04          
J033068E24          
J033076D01          
J033088O06          
J033093K15          
J033101G18          
J033130A01          
J043027I17          
J043027L17          
J090001N13          
J090004L10          
J090027D08          
J090027H18          
J090031F16          
J090048L18          
J090050N08          
J090051G05          
J090063G03          
J090068P21          
J090072P21          
J090079A14          
J090086I20          
J090087D19          
J090099B06          
J100047J19          
J100058I06          
TSS from cDNA
TSS information
J013146N16                       5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013146N16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-40790896-429

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCCCTCTC-4079085340790862-386-395
Y PatchCCTCTCCTC-4079090240790910-435-443
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCACGCGGAGAG-4079098240790994-515-527
 OsREG555CGCACGCG      PPDB Motif  PLACE Motif 
 OsREG576     GCGGAGAG PPDB Motif  PLACE Motif 
REGCCTCGCCC-4079100940791016-542-549
 OsREG549CCTCGCCC PPDB MotifGCCCA  PLACE Motif 
REGCATCCCCCATCCAACGGC-4079115540791172-688-705
 OsREG516CATCCCCC           PPDB Motif  PLACE Motif 
 OsREG482 ATCCCCCA          PPDB Motif  PLACE Motif 
 OsREG534     CCCATCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG481        ATCCAACG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG548         TCCAACGG  PPDB MotifCCAACGG  PLACE Motif 
 OsREG518          CCAACGGC PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.