version
PlantPromoterDB promoter information of J013149D12

Summary of Gene (J013149D12)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0809300        NCBI 
Gene model J013149D12  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 34701129-34699930)

Genome position     
from initiation codon
011-024-C02         
016-071-E09         
AK103140            
J013030O08          
J013108D19          
J013124D15          
J013128F17          
J013146J06          
J013154P12          
J013162N01          
J013170G15          
J013170H16          
J023022I09          
J023072B19          
J023106H09          
J023135C03          
J023141C09          
J033091K23          
J033107I05          
J033112M18          
J033120G10          
J033144G06          
J043017L21          
J043024O10          
J053023K04          
J053035D01          
J053037P10          
J053042K15          
J053047C14          
J053054A06          
J053071H03          
J053073G08          
J053090D04          
J053095E17          
J090007O03          
J090024G24          
J090042M08          
J090045I16          
J090051E13          
J090073B15          
J090096F19          
J100030M23          
TSS from cDNA
TSS information
J013149D12                       5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013149D12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-34700580-451

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGCCCATTT-3470062934700639-500-510
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422   GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGTATTGGGCCCAGAT-3470064934700662-520-533
 OsREG596TATTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG579    GGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG629     GGCCCAGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG486      GCCCAGAT PPDB MotifGCCCA  PLACE Motif 
REGTATTGGGCTTA-3470068434700694-555-565
 OsREG596TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG460 ATTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG426  TTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG655   TGGGCTTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.