version
PlantPromoterDB promoter information of J013151E01

Summary of Gene (J013151E01)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0548100        NCBI 
Gene model J013151E01  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 27277652-27278851)

Genome position     
from initiation codon
AK060333            
AK100682            
J023113L22          
J043027A19          
J075093E06          
J090060D15          
J090082J03          
J100050E01          
TSS from cDNA
TSS information
J013151E01                       5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013151E01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+27278596-56

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCT+2727858627278593-66-59
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCGGCCC+2727830027278307-352-345
 OsREG615GCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGTGTGGGGCCGTG+2727831227278325-340-327
 OsREG526CGTGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG535 GTGTGGGG      PPDB Motif  PLACE Motif 
 OsREG611  TGTGGGGC     PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC    PPDB Motif  PLACE Motif 
 OsREG504      GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCTGG+2727834627278355-306-297
 OsREG461TGTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG523  TGGGCTGG PPDB MotifGCCCA  PLACE Motif 
REGCACGGCCCGGT+2727836127278371-291-281
 OsREG504CACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG446 ACGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG544  CGGCCCGG  PPDB Motif  PLACE Motif 
 OsREG441   GGCCCGGT PPDB Motif  PLACE Motif 
REGCGGGCCGTGCCGGCCC+2727838027278395-272-257
 OsREG446CGGGCCGT         PPDB MotifACGGGC  PLACE Motif 
 OsREG504 GGGCCGTG        PPDB MotifGCCCA  PLACE Motif 
 OsREG615        GCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCTCGGCCCAAG+2727840327278413-249-239
 OsREG575CTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581   GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGGGCCGGGCC+2727841727278425-235-227
 OsREG614GGCCGGGC  PPDB Motif  PLACE Motif 
 OsREG616 GCCGGGCC PPDB Motif  PLACE Motif 
REGGCGGCCCAGAT+2727844427278454-208-198
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG486   GCCCAGAT PPDB MotifGCCCA  PLACE Motif 
REGTACTGGGCCTT+2727846427278474-188-178
 OsREG604TACTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG473  CTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT PPDB MotifGCCCA  PLACE Motif 
REGTTTCGGCCCAAGGCCCATAT+2727848027278499-172-153
 OsREG634TTTCGGCC             PPDB Motif  PLACE Motif 
 OsREG642 TTCGGCCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TCGGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG563   CGGCCCAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG581    GGCCCAAG         PPDB MotifGCCCA  PLACE Motif 
 OsREG497        CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430         AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474          AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630           GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480            GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGAGCCGTCCGATCCG+2727850127278514-151-138
 OsREG468AGCCGTCC       PPDB Motif  PLACE Motif 
 OsREG562 GCCGTCCG      PPDB Motif  PLACE Motif 
 OsREG545  CCGTCCGA     PPDB Motif  PLACE Motif 
 OsREG484   CGTCCGAT    PPDB Motif  PLACE Motif 
 OsREG589    GTCCGATC   PPDB Motif  PLACE Motif 
 OsREG541      CCGATCCG PPDB Motif  PLACE Motif 
REGCGTCCGATC+2727853327278541-119-111
 OsREG484CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589 GTCCGATC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.