version
PlantPromoterDB promoter information of J013151P06

Summary of Gene (J013151P06)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0564600        NCBI 
Gene model J013151P06  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 28690817-28692016)

Genome position     
from initiation codon
009-038-A02         
AK105145            
AK120614            
J013102D16          
J033082C11          
J065073N13          
J065142E11          
J065187I19          
J065204K02          
J090089P22          
J100060B16          
TSS from cDNA
TSS information
J013151P06                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013151P06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+28691727-90

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCCCT+2869169028691697-127-120
Y PatchTTCCCCTCTCCTCTT+2869172928691743-88-74
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACTGGGCCTC+2869157828691588-239-229
 OsREG425AACTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG473  CTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCCATAAGGCCCACGT+2869160128691621-216-196
 OsREG538CCCGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA           PPDB MotifGCCCA  PLACE Motif 
 OsREG605    GCCCATAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG430          AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472           AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571            GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG449             GCCCACGT PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
REGCTCCCCCA+2869166328691670-154-147
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.