version
PlantPromoterDB promoter information of J013156L15

Summary of Gene (J013156L15)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0182700        NCBI 
Gene model J013156L15  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 4951474-4952673)

Genome position     
from initiation codon
003-102-E07         
011-019-D04         
012-011-G05         
012-013-A06         
013-068-D09         
014-032-G03         
AK065911            
AK102592            
AK104343            
J013045E01          
J023029P17          
J023134I24          
J033098G02          
J033099A10          
J033107O10          
J033115L16          
J065020N18          
J065113C09          
J090007M24          
J090014N08          
J090019F02          
J090048N24          
J090050K16          
J090088F21          
TSS from cDNA
TSS information
J013156L15                       5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013156L15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+4952347-127

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTCTCTCTCCC+49523064952319-168-155
Y PatchCCCCTCCTCC+49523544952363-120-111
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGAGTGGG+49520984952105-376-369
 OsREG532GGAGTGGG PPDB MotifGCCCA  PLACE Motif 
REGTTGTGGGCCGAGAT+49521114952124-363-350
 OsREG597TTGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG627 TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG564  GTGGGCCG     PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA    PPDB MotifGCCCA  PLACE Motif 
 OsREG575    GGGCCGAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG635     GGCCGAGA  PPDB Motif  PLACE Motif 
 OsREG485      GCCGAGAT PPDB Motif  PLACE Motif 
REGCCCGGCCCATGA+49521364952147-338-327
 OsREG538CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517   GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609    GCCCATGA PPDB MotifGCCCA  PLACE Motif 
REGCCACTGACATGTGGGCCCAACT+49522714952292-203-182
 OsREG522CCACTGAC               PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA              PPDB Motif  PLACE MotifTGAC 
 OsREG627         TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640          GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG639            GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626             GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479              GCCCAACT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.