version
PlantPromoterDB promoter information of J013156N02

Summary of Gene (J013156N02)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0744000        NCBI 
Gene model J013156N02  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 32088166-32089365)

Genome position     
from initiation codon
AK064898            
AK104827            
J013000L12          
J065001H14          
J065038D18          
J065039I18          
J065047C13          
J065053J09          
J065064G03          
J065066M05          
J065068O10          
J065090H22          
J065113L19          
J065121M02          
J065138C12          
J065153E14          
J065156N12          
J065166I06          
J065174L15          
J065175N03          
J090092C23          
TSS from cDNA
TSS information
J013156N02                       5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013156N02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+32089094-72

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTCCGAT+3208880432088811-362-355
 OsREG484CGTCCGAT PPDB Motif  PLACE Motif 
REGCGGACGGA+3208886032088867-306-299
 OsREG561CGGACGGA PPDB Motif  PLACE Motif 
REGAACGGGCC+3208887532088882-291-284
 OsREG424AACGGGCC PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGAGCCCACGGG+3208888632088895-280-271
 OsREG463AGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG547 GCCCACGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG531  CCCACGGG PPDB MotifGCCCA, ACGGGC  PLACE Motif 
REGTCCGGCCCAAAC+3208891032088921-256-245
 OsREG644TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625   GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593    GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGCCAAGCCCAAAA+3208896832088979-198-187
 OsREG519CCAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG496 CAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426  AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457   AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592    GCCCAAAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.