version
PlantPromoterDB promoter information of J013158A22

Summary of Gene (J013158A22)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0148600        NCBI 
Gene model J013158A22  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 2762054-2760855)

Genome position     
from initiation codon
003-016-C11         
AK066168            
AK104336            
AY360145            
J013055J22          
J013057M24          
J013074N03          
J075118H09          
TSS from cDNA
TSS information
J013158A22                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013158A22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-2761592-538

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCTCT-27615502761560-496-506
Y PatchTTCCCCTC-27616092761616-555-562
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACAGGTGG-27616362761644-582-590
 OsREG501GACAGGTG  PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG PPDB Motif  PLACE Motif 
REGGGTGGGGCCCGTT-27616542761666-600-612
 OsREG612GGTGGGGC      PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG567   GGGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG424     GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGGGGCCCCACCCG-27617002761711-646-657
 OsREG641GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631 GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612  GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG528    CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGCCACTGACAGG-27617302761740-676-686
 OsREG522CCACTGAC    PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA   PPDB Motif  PLACE MotifTGAC 
 OsREG453  ACTGACAG  PPDB Motif  PLACE MotifTGAC 
 OsREG551   CTGACAGG PPDB Motif  PLACE MotifTGAC 
REGGCCACGTC-27618072761814-753-760
 OsREG585GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCGGGTGGGCCCCACACACACC-27618192761839-765-785
 OsREG528CGGGTGGG              PPDB MotifGCCCA  PLACE Motif 
 OsREG600 GGGTGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG631      GGCCCCAC        PPDB Motif  PLACE Motif 
 OsREG611       GCCCCACA       PPDB Motif  PLACE Motif 
 OsREG535        CCCCACAC      PPDB Motif  PLACE Motif 
 OsREG499             CACACACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.