version
PlantPromoterDB promoter information of J013158K07

Summary of Gene (J013158K07)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0716200        NCBI 
Gene model J013158K07  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 31563052-31561853)

Genome position     
from initiation codon
AK062106            
AK098920            
AK120664            
J013002N06          
J013050O19          
J013074N19          
J013098J01          
J013127F17          
J013155C17          
J013159J10          
J053086D01          
TSS from cDNA
TSS information
J013158K07                       5'->3' (-)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013158K07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-31562715-663
TSS clone peakGclone-31562377-325

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCCCTC-3156274231562751-690-699
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTCGCGCGC-3156257531562583-523-531
 OsREG558CTCGCGCG  PPDB MotifACGCGC  PLACE Motif 
 OsREG617 TCGCGCGC PPDB Motif  PLACE Motif 
REGGTGCGGTGCG-3156260431562613-552-561
 OsREG500GTGCGGTG   PPDB Motif  PLACE Motif 
 OsREG554  GCGGTGCG PPDB Motif  PLACE Motif 
REGCTGTCAGT-3156280431562811-752-759
 OsREG453CTGTCAGT PPDB Motif  PLACE MotifTGAC 
REGTGTGGGCCCCCGCG-3156282931562842-777-790
 OsREG627TGTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG537      CCCCCGCG PPDB Motif  PLACE Motif 
REGTCTGGCCCCACC-3156289031562901-838-849
 OsREG638TCTGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612    GCCCCACC PPDB Motif  PLACE Motif 
REGGTGTCACTGACAG-3156291831562930-866-878
 OsREG477GTGTCACT      PPDB Motif  PLACE MotifTGAC 
 OsREG510    CACTGACA  PPDB Motif  PLACE MotifTGAC 
 OsREG453     ACTGACAG PPDB Motif  PLACE MotifTGAC 
REGAGCCGTTGGA-3156296231562971-910-919
 OsREG469AGCCGTTG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG518 GCCGTTGG  PPDB MotifCCAACGG  PLACE Motif 
 OsREG548  CCGTTGGA PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.