version
PlantPromoterDB promoter information of J013159M16

Summary of Gene (J013159M16)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0379300        NCBI 
Gene model J013159M16  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 15550281-15551480)

Genome position     
from initiation codon
006-039-F11         
AK061515            
AK068704            
J090067F01          
J090083F21          
J100040M08          
J100048C03          
J100056M07          
J100062N22          
J100086L07          
TSS from cDNA
TSS information
J013159M16                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013159M16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+15551056-225

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCTCCTCCTC+1555106515551080-216-201
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTGTGGC+1555075915550766-522-515
 OsREG573CGTGTGGC PPDB Motif  PLACE Motif 
REGCACGTGGC+1555084015550847-441-434
 OsREG507CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCTGGCCCACCAC+1555085015550861-431-420
 OsREG577CTGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527    CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGGACAGGTGGGCCCGTT+1555088615550901-395-380
 OsREG501GACAGGTG         PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG        PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG476   AGGTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640     GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG566      TGGGCCCG   PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG424        GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGGCCCCCACGTG+1555091215550922-369-359
 OsREG613GCCCCCAC    PPDB Motif  PLACE Motif 
 OsREG536 CCCCCACG   PPDB Motif  PLACE Motif 
 OsREG450  CCCCACGT  PPDB MotifACGT  PLACE Motif 
 OsREG508   CCCACGTG PPDB MotifACGT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.