version
PlantPromoterDB promoter information of J013159M18

Summary of Gene (J013159M18)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0558200        NCBI 
Gene model J013159M18  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 23019701-23020900)

Genome position     
from initiation codon
016-083-C09         
AK068834            
AK103673            
J065022I04          
J065089B19          
TSS from cDNA
TSS information
J013159M18                       5'->3' (+)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013159M18

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+23019734-967
TSS clone peakGclone+23020111-590

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCT+2301970323019710-998-991
Y PatchCTCCCTCTC+2302008623020094-615-607
Y PatchTCTCCCCC+2302010223020109-599-592
Y PatchCCTTCCCT+2302012223020129-579-572
Y PatchCTCCCTCTC+2302013823020146-563-555
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCGAGGCGTGGTCAGTGG+2301955423019573-1147-1128
 OsREG549GGGCGAGG             PPDB MotifGCCCA  PLACE Motif 
 OsREG503    GAGGCGTG         PPDB Motif  PLACE Motif 
 OsREG522            GTCAGTGG PPDB Motif  PLACE MotifTGAC 
REGGCGGGCCCC+2301965823019666-1043-1035
 OsREG619GCGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG567 CGGGCCCC PPDB MotifACGGGC  PLACE Motif 
REGGGCCGTGGCGCGGGT+2301981623019830-885-871
 OsREG521GGCCGTGG        PPDB Motif  PLACE Motif 
 OsREG439       GCGCGGGT PPDB Motif  PLACE Motif 
REGTCCGTCCG+2301983723019844-864-857
 OsREG561TCCGTCCG PPDB Motif  PLACE Motif 
REGGATCCGACG+2301990923019917-792-784
 OsREG588GATCCGAC  PPDB MotifCCGAC  PLACE Motif 
 OsREG483 ATCCGACG PPDB MotifCCGAC  PLACE MotifCGACG 
REGCCCACGGG+2301998323019990-718-711
 OsREG531CCCACGGG PPDB MotifGCCCA, ACGGGC  PLACE Motif 
REGGGACGGACGGA+2302001423020024-687-677
 OsREG623GGACGGAC    PPDB Motif  PLACE Motif 
 OsREG561   CGGACGGA PPDB Motif  PLACE Motif 
REGCCCACCAC+2302006023020067-641-634
 OsREG527CCCACCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.