version
PlantPromoterDB promoter information of J023003J21

Summary of Gene (J023003J21)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0460800        NCBI 
Gene model J023003J21  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 16348426-16347227)

Genome position     
from initiation codon
003-112-C01         
006-030-F04         
AK066287            
AK104229            
J013064I06          
J013099F11          
J023041B18          
J023085H12          
J080302N13          
J080303B11          
J080309G24          
J080310G23          
J080310J01          
J080311H13          
J080311N21          
J090076I20          
J100047N10          
J100061D16          
J100073M11          
J100082H14          
J100090L24          
TSS from cDNA
TSS information
J023003J21                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023003J21

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-16347547-121

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCCCCCTCCCCC-1634751916347533-93-107
Y PatchCCCCTTCC-1634756316347570-137-144
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGGCCCACCA-1634765316347663-227-237
 OsREG566CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640 GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGCACTGACACGTGGGCCAC-1634768316347700-257-274
 OsREG510CACTGACA           PPDB Motif  PLACE MotifTGAC 
 OsREG509    GACACGTG       PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434     ACACGTGG      PPDB MotifACGT  PLACE Motif 
 OsREG508      CACGTGGG     PPDB MotifACGT  PLACE Motif 
 OsREG449       ACGTGGGC    PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571        CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654         GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653          TGGGCCAC PPDB MotifGCCCA  PLACE Motif 
REGCCCACCAC-1634771716347724-291-298
 OsREG527CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGGCCCACACGCCAC-1634776016347772-334-346
 OsREG598GCCCACAC      PPDB MotifGCCCA  PLACE Motif 
 OsREG526 CCCACACG     PPDB MotifGCCCA  PLACE Motif 
 OsREG502     CACGCCAC PPDB Motif  PLACE Motif 
REGCCCGTGGGTCCCACC-1634779516347809-369-383
 OsREG531CCCGTGGG        PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG622   GTGGGTCC     PPDB MotifGGGACCC  PLACE Motif 
 OsREG637    TGGGTCCC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG648     GGGTCCCA   PPDB MotifGGGACCC  PLACE Motif 
 OsREG650      GGTCCCAC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG651       GTCCCACC PPDB MotifGGGACCC  PLACE Motif 
REGCACTGACA-1634783516347842-409-416
 OsREG510CACTGACA PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.