version
PlantPromoterDB promoter information of J023003L18

Summary of Gene (J023003L18)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0141200        NCBI 
Gene model J023003L18  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 2250557-2251756)

Genome position     
from initiation codon
AK068968            
AK100092            
J023022K18          
J023107H13          
J023107K02          
TSS from cDNA
TSS information
J023003L18                       5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023003L18

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+2251302-255

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCTT+22512852251293-272-264
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCACGCGTCGCG+22510292251043-528-514
 OsREG463AGCCCACG        PPDB MotifGCCCA  PLACE Motif 
 OsREG602 GCCCACGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG530  CCCACGCG      PPDB MotifGCCCA  PLACE Motif 
 OsREG443   CCACGCGT     PPDB Motif  PLACE Motif 
 OsREG559      CGCGTCGC  PPDB Motif  PLACE MotifCGACG 
 OsREG556       GCGTCGCG PPDB Motif  PLACE MotifCGACG 
REGGCCCCACCGCGCGCGACGTGGC+22510522251073-505-484
 OsREG612GCCCCACC               PPDB Motif  PLACE Motif 
 OsREG617        GCGCGCGA       PPDB Motif  PLACE Motif 
 OsREG557         CGCGCGAC      PPDB MotifACGCGC  PLACE Motif 
 OsREG585              GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCCCATTT+22511682251175-389-382
 OsREG422GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGCCCCCGCG+22511772251184-380-373
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGCGCACCGC+22512002251207-357-350
 OsREG554CGCACCGC PPDB Motif  PLACE Motif 
REGCGCCACGTCACCCGCACGCG+22512362251255-321-302
 OsREG448CGCCACGT             PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585 GCCACGTC            PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG505   CACGTCAC          PPDB MotifACGT  PLACE MotifTGAC 
 OsREG447    ACGTCACC         PPDB MotifACGT  PLACE MotifTGAC 
 OsREG555            CGCACGCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.