version
PlantPromoterDB promoter information of J023009L14

Summary of Gene (J023009L14)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0970400        NCBI 
Gene model J023009L14  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 44605873-44607072)

Genome position     
from initiation codon
AK069207            
AK099169            
J023086O18          
J075025G03          
J075198E21          
J090004B14          
J090071P11          
J100075A22          
U34597              
TSS from cDNA
TSS information
J023009L14                       5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023009L14

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+44606813-60

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCACGTC+4460653844606545-335-328
 OsREG585GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGATTTGGGCCCATGGGCCTGATAAGCCCAAC+4460669944606728-174-145
 OsREG493ATTTGGGC                       PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG489    GGGCCCAT                   PPDB MotifGCCCA  PLACE Motif 
 OsREG525      GCCCATGGGC               PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517     GGCCCATGGGCC              PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG474          ATGGGCCT             PPDB MotifGCCCA  PLACE Motif 
 OsREG513           TGGGCCTG            PPDB MotifGCCCA  PLACE Motif 
 OsREG646            GGGCCTGA           PPDB MotifGCCCA  PLACE Motif 
 OsREG655                    TAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG426                     AAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG458                      AGCCCAAC PPDB MotifGCCCA, CCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.