version
PlantPromoterDB promoter information of J023014L15

Summary of Gene (J023014L15)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0302900        NCBI 
Gene model J023014L15  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 10734896-10736095)

Genome position     
from initiation codon
011-005-H01         
AK069222            
J033023G12          
J090008H16          
TSS from cDNA
TSS information
J023014L15                       5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023014L15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+10734978-918

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCGTTG+1073476310734770-1133-1126
 OsREG469AGCCGTTG PPDB MotifCCAACGG  PLACE Motif 
REGCCCACCAC+1073479110734798-1105-1098
 OsREG527CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGCACACACC+1073480010734807-1096-1089
 OsREG499CACACACC PPDB Motif  PLACE Motif 
REGTCCACGCCAC+1073481910734828-1077-1068
 OsREG636TCCACGCC   PPDB Motif  PLACE Motif 
 OsREG502  CACGCCAC PPDB Motif  PLACE Motif 
REGCGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGT+1073484610734883-1050-1013
 OsREG452CGACACGT                               PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509 GACACGTG                              PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  ACACGTGG                             PPDB MotifACGT  PLACE Motif 
 OsREG508   CACGTGGG                            PPDB MotifACGT  PLACE Motif 
 OsREG650      GTGGGACC                         PPDB MotifGGGACCC  PLACE Motif 
 OsREG648       TGGGACCC                        PPDB MotifGGGACCC  PLACE Motif 
 OsREG637        GGGACCCA                       PPDB MotifGGGACCC  PLACE Motif 
 OsREG622         GGACCCAC                      PPDB MotifGGGACCC  PLACE Motif 
 OsREG528            CCCACCCG                   PPDB MotifGCCCA  PLACE Motif 
 OsREG439               ACCCGCGC                PPDB Motif  PLACE Motif 
 OsREG572                      CGTGGGGC         PPDB Motif  PLACE Motif 
 OsREG631                       GTGGGGCC        PPDB Motif  PLACE Motif 
 OsREG641                        TGGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647                         GGGGCCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG640                          GGGCCCAC     PPDB MotifGCCCA  PLACE Motif 
 OsREG571                           GGCCCACG    PPDB MotifGCCCA  PLACE Motif 
 OsREG602                            GCCCACGC   PPDB MotifGCCCA  PLACE Motif 
 OsREG530                    CGCGTGGG CCCACGCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG443                              CCACGCGT PPDB Motif  PLACE Motif 
REGCCACCAAC+1073489610734903-1000-993
 OsREG520CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGGGGGCCCACCT+1073491210734922-984-974
 OsREG647GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476   GCCCACCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.