version
PlantPromoterDB promoter information of J023020I01

Summary of Gene (J023020I01)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0749900        NCBI 
Gene model J023020I01  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 31662250-31663449)

Genome position     
from initiation codon
006-112-A05         
AK061252            
J033060N21          
J090023D14          
J090067P15          
TSS from cDNA
TSS information
J023020I01                       5'->3' (+)
Promoter sequence









 
AK111604            
AK111770            
J013098L24          
J023067A13          
J090025E20          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023020I01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+31663227-23

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTCTCCGC+3166303831663045-212-205
 OsREG576CTCTCCGC PPDB Motif  PLACE Motif 
REGCGCGACGC+3166307631663083-174-167
 OsREG556CGCGACGC PPDB Motif  PLACE MotifCGACG 
REGCTCGGCCCACCTAGGCCCATTT+3166312031663141-130-109
 OsREG575CTCGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC             PPDB MotifGCCCA  PLACE Motif 
 OsREG628   GGCCCACC            PPDB MotifGCCCA  PLACE Motif 
 OsREG476    GCCCACCT           PPDB MotifGCCCA  PLACE Motif 
 OsREG656           TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474            AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431             GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422              GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGCCAGCCCATTGAGGCCCATGGGCT+3166314531663168-105-82
 OsREG523CCAGCCCA                 PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT                PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT               PPDB MotifGCCCA  PLACE Motif 
 OsREG587          GAGGCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG474           AGGCCCAT      PPDB MotifGCCCA  PLACE Motif 
 OsREG517            GGCCCATG     PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525             GCCCATGGGC  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG467                CATGGGCT PPDB MotifGCCCA, CCATGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.