version
PlantPromoterDB promoter information of J023022F15

Summary of Gene (J023022F15)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0636300        NCBI 
Gene model J023022F15  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 26400719-26399520)

Genome position     
from initiation codon
AK100670            
J013149P11          
J023112J15          
J023145M22          
J043017P16          
TSS from cDNA
TSS information
J023022F15                       5'->3' (-)
Promoter sequence














 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023022F15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-26400448-729

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCCTC-2640045726400464-738-745
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAATGGGCTGGGCCGGGCCGGC-2640052326400544-804-825
 OsREG610TAATGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT              PPDB MotifGCCCA  PLACE Motif 
 OsREG491  ATGGGCTG             PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG            PPDB MotifGCCCA  PLACE Motif 
 OsREG533    GGGCTGGG           PPDB MotifGCCCA  PLACE Motif 
 OsREG603     GGCTGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG620      GCTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG565       CTGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG542        TGGGCCGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG538         GGGCCGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG614          GGCCGGGC     PPDB Motif  PLACE Motif 
 OsREG616           GCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544            CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG615              GGGCCGGC PPDB MotifGCCCA  PLACE Motif 
REGATCTGGGC-2640055826400565-839-846
 OsREG486ATCTGGGC PPDB MotifGCCCA  PLACE Motif 
REGCCGTGGGCCGTGG-2640059826400610-879-891
 OsREG547CCGTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG564  GTGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504    GGGCCGTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG521     GGCCGTGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.