version
PlantPromoterDB promoter information of J023024H24

Summary of Gene (J023024H24)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0121000        NCBI 
Gene model J023024H24  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 1094517-1095716)

Genome position     
from initiation codon
009-006-H12         
009-181-E02         
AK058867            
AK071341            
J023090B22          
J023111G15          
J023134K14          
J033057C05          
J033067J15          
J033084L15          
J033088B04          
J043027A08          
J043029L03          
J053031K22          
J053046I01          
J053070B05          
J053072C10          
J065097M22          
J065164I17          
J075058I08          
J075064C09          
J080304C16          
J080304H16          
J080306E17          
J080310L03          
J080316J07          
J080317L23          
J080319A10          
J090060F01          
J100042N16          
J100047F05          
J100075J19          
TSS from cDNA
TSS information
J023024H24                       5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023024H24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+1093820-647
TSS clone peakTclone+1093910-557

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCGTATAAATC+10937861093796-681-671
Y PatchCCCCTCCTCCTCCT+10939111093924-556-543
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGTGGGCCTT+10937031093713-764-754
 OsREG597TTGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG627 TGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472  GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT PPDB MotifGCCCA  PLACE Motif 
REGCAAGCCCAC+10937151093723-752-744
 OsREG496CAAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCAGG+10937341093743-733-724
 OsREG656TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG473 AGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG550  GGCCCAGG PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCCCACTAGGCCCAACC+10937531093775-714-692
 OsREG593GTTTGGGC                PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC            PPDB MotifGCCCA  PLACE Motif 
 OsREG478     GGCCCACT           PPDB MotifGCCCA  PLACE Motif 
 OsREG656            TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471             AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626              GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595               GCCCAACC PPDB MotifGCCCA  PLACE Motif 
REGGCGGAGAG+10938591093866-608-601
 OsREG576GCGGAGAG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.