version
PlantPromoterDB promoter information of J023024L22

Summary of Gene (J023024L22)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0519800        NCBI 
Gene model J023024L22  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 25867919-25869118)

Genome position     
from initiation codon
AK069435            
TSS from cDNA
TSS information
J023024L22                       5'->3' (+)
Promoter sequence








 
012-041-G06         
014-100-B04         
AF332981            
AK100903            
AK105433            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023024L22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+25868877-42

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCTCCTCCTCC+2586884225868856-77-63
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGTCCCAC+2586859325868601-326-318
 OsREG648GGGTCCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG650 GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 
REGGCCACGTGGCG+2586869125868701-228-218
 OsREG507GCCACGTGGC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG448   ACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGCTGGCCCAGC+2586870825868717-211-202
 OsREG577CTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGATCCAACGGCT+2586875325868763-166-156
 OsREG481ATCCAACG    PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG518  CCAACGGC  PPDB MotifCCAACGG  PLACE Motif 
 OsREG469   CAACGGCT PPDB MotifCCAACGG  PLACE Motif 
REGGGCGTGGA+2586877425868781-145-138
 OsREG636GGCGTGGA PPDB Motif  PLACE Motif 
REGCCGAGCCGTCC+2586878725868797-132-122
 OsREG540CCGAGCCG    PPDB Motif  PLACE Motif 
 OsREG468   AGCCGTCC PPDB Motif  PLACE Motif 
REGCGCGTCGCGTC+2586882425868834-95-85
 OsREG559CGCGTCGC    PPDB Motif  PLACE MotifCGACG 
 OsREG556 GCGTCGCG   PPDB Motif  PLACE MotifCGACG 
 OsREG583   GTCGCGTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-25868407AK105433, AF332981, AK100903, AK105433, 014-100-B04

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCC-2586836925868376014-100-B04, AF332981, AK100903, AK105433
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTCGTGGGCCCCACA-2586850625868519014-100-B04, AF332981, AK100903, AK105433
 OsREG601TCGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611      GCCCCACA PPDB Motif  PLACE Motif 
REGATCCAACGG-2586853025868538014-100-B04, AF332981, AK100903, AK105433
 OsREG481ATCCAACG  PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG PPDB MotifCCAACGG  PLACE Motif 
REGCGCGTCGCCCATCG-2586855625868569014-100-B04, AF332981, AK100903, AK105433
 OsREG559CGCGTCGC       PPDB Motif  PLACE MotifCGACG 
 OsREG553      GCCCATCG PPDB MotifGCCCA  PLACE Motif 
REGGTGGGACCC-2586859325868601014-100-B04, AF332981, AK100903, AK105433
 OsREG650GTGGGACC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG648 TGGGACCC PPDB MotifGGGACCC  PLACE Motif 
REGCGCCACGTGGC-2586869125868701014-100-B04, AF332981, AK100903, AK105433
 OsREG448CGCCACGT    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507 GCCACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.