version
PlantPromoterDB promoter information of J023034H09

Summary of Gene (J023034H09)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0135600        NCBI 
Gene model J023034H09  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 1883464-1882265)

Genome position     
from initiation codon
AK069843            
J033090D08          
J100025N07          
J100075G18          
TSS from cDNA
TSS information
J023034H09                       5'->3' (-)
Promoter sequence









 
AK100570            
J023105B17          
J065190D05          
J090015H17          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence









 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023034H09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-1882475-11

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTGGGGCC-18825151882522-51-58
 OsREG580CTGGGGCC PPDB Motif  PLACE Motif 
REGGACACGTGGGGG-18825351882546-71-82
 OsREG509GACACGTG     PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434 ACACGTGG    PPDB MotifACGT  PLACE Motif 
 OsREG508  CACGTGGG   PPDB MotifACGT  PLACE Motif 
 OsREG450   ACGTGGGG  PPDB MotifACGT  PLACE Motif 
 OsREG536    CGTGGGGG PPDB Motif  PLACE Motif 
REGGACACGTGGGG-18825571882567-93-103
 OsREG509GACACGTG    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434 ACACGTGG   PPDB MotifACGT  PLACE Motif 
 OsREG508  CACGTGGG  PPDB MotifACGT  PLACE Motif 
 OsREG450   ACGTGGGG PPDB MotifACGT  PLACE Motif 
REGGCCGGCCCAGTTAGGCCCACA-18825941882614-130-150
 OsREG615GCCGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG            PPDB MotifGCCCA  PLACE Motif 
 OsREG454   GGCCCAGT           PPDB MotifGCCCA  PLACE Motif 
 OsREG425    GCCCAGTT          PPDB MotifGCCCA  PLACE Motif 
 OsREG656           TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG472            AGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627             GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGTGCGGCCCAATTCAGCCCATGT-18826201882641-156-177
 OsREG643TGCGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG618 GCGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA             PPDB MotifGCCCA  PLACE Motif 
 OsREG492   GGCCCAAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG433    GCCCAATT           PPDB MotifGCCCA  PLACE Motif 
 OsREG657           TCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491            CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG467             AGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437              GCCCATGT PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCAAG-18826561882665-192-201
 OsREG587GAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581  GGCCCAAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+1882715AK100570, AK100570

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGACTATA+18826741882681AK100570
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGGCTCGG+18824451882452AK100570
 OsREG540CGGCTCGG PPDB Motif  PLACE Motif 
REGGGTGGGCCCCAG+18825111882522AK100570
 OsREG628GGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG580    GGCCCCAG PPDB Motif  PLACE Motif 
REGCCCCCACGTGTC+18825351882546AK100570
 OsREG536CCCCCACG     PPDB Motif  PLACE Motif 
 OsREG450 CCCCACGT    PPDB MotifACGT  PLACE Motif 
 OsREG508  CCCACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG434   CCACGTGT  PPDB MotifACGT  PLACE Motif 
 OsREG509    CACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCCCACGTGTC+18825571882567AK100570
 OsREG450CCCCACGT    PPDB MotifACGT  PLACE Motif 
 OsREG508 CCCACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG434  CCACGTGT  PPDB MotifACGT  PLACE Motif 
 OsREG509   CACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGTGTGGGCCTAACTGGGCCGGC+18825941882614AK100570
 OsREG627TGTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG472 GTGGGCCT             PPDB MotifGCCCA  PLACE Motif 
 OsREG656  TGGGCCTA            PPDB MotifGCCCA  PLACE Motif 
 OsREG425         AACTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG454          ACTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565           CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542            TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG615             GGGCCGGC PPDB MotifGCCCA  PLACE Motif 
REGACATGGGCTGAATTGGGCCGCA+18826201882641AK100570
 OsREG437ACATGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG467 CATGGGCT              PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG491  ATGGGCTG             PPDB MotifGCCCA  PLACE Motif 
 OsREG657   TGGGCTGA            PPDB MotifGCCCA  PLACE Motif 
 OsREG433          AATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG492           ATTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG563            TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG618             TGGGCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG643              GGGCCGCA PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCCTC+18826561882665AK100570
 OsREG581CTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471 TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587  TGGGCCTC PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.