version
PlantPromoterDB promoter information of J023036J15

Summary of Gene (J023036J15)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0128100        NCBI 
Gene model J023036J15  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 1629243-1630442)

Genome position     
from initiation codon
009-051-B07         
009-127-B08         
009-144-H03         
009-176-B05         
AK108556            
AK119308            
AK120934            
J065122L01          
J075104P10          
TSS from cDNA
TSS information
J023036J15                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023036J15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+1630069-174
TSS clone peakCclone+1630073-170
TSS cloneAclone+1630074-169

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACAGCCCATTT+16298161629826-427-417
 OsREG435ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422   GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGATTGGGCTTG+16299161629925-327-318
 OsREG460ATTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG426 TTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG496  TGGGCTTG PPDB MotifGCCCA  PLACE Motif 
REGTAATGGGCTTC+16299271629937-316-306
 OsREG610TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG582   TGGGCTTC PPDB MotifGCCCA  PLACE Motif 
REGCCTGGGCCTGA+16299431629953-300-290
 OsREG550CCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG473 CTGGGCCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG513  TGGGCCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG646   GGGCCTGA PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCCGCCGGCCCATCT+16299651629984-278-259
 OsREG581CTTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG563 TTGGGCCG            PPDB MotifGCCCA  PLACE Motif 
 OsREG618  TGGGCCGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG615        GCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542         CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490          CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590           GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456            GCCCATCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.