version
PlantPromoterDB promoter information of J023039H03

Summary of Gene (J023039H03)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0714000        NCBI 
Gene model J023039H03  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 31156856-31155657)

Genome position     
from initiation codon
AK069538            
AK121079            
J023020A02          
J023062M13          
J043020D18          
J065073A17          
J065158D09          
J065163E15          
J065195H04          
J065214P13          
J080079I22          
J100031M06          
J100036I12          
J100042E23          
J100069N01          
J100089L13          
TSS from cDNA
TSS information
J023039H03                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023039H03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-31156004-148

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCACCTGTCAGT-3115605331156065-197-209
 OsREG514CCCACCTG      PPDB MotifGCCCA  PLACE Motif 
 OsREG436 CCACCTGT     PPDB Motif  PLACE Motif 
 OsREG501  CACCTGTC    PPDB Motif  PLACE Motif 
 OsREG551    CCTGTCAG  PPDB Motif  PLACE MotifTGAC 
 OsREG453     CTGTCAGT PPDB Motif  PLACE MotifTGAC 
REGCGGGTCCCACCAC-3115607531156087-219-231
 OsREG569CGGGTCCC      PPDB MotifGGGACCC  PLACE Motif 
 OsREG648 GGGTCCCA     PPDB MotifGGGACCC  PLACE Motif 
 OsREG650  GGTCCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG651   GTCCCACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG527     CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGCCCACTCT-3115609831156105-242-249
 OsREG455CCCACTCT PPDB Motif  PLACE Motif 
REGCCCACCTGTCAGTG-3115610931156122-253-266
 OsREG514CCCACCTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG436 CCACCTGT      PPDB Motif  PLACE Motif 
 OsREG501  CACCTGTC     PPDB Motif  PLACE Motif 
 OsREG551    CCTGTCAG   PPDB Motif  PLACE MotifTGAC 
 OsREG453     CTGTCAGT  PPDB Motif  PLACE MotifTGAC 
 OsREG510      TGTCAGTG PPDB Motif  PLACE MotifTGAC 
REGTGGGTCCCACCAC-3115613331156145-277-289
 OsREG637TGGGTCCC      PPDB MotifGGGACCC  PLACE Motif 
 OsREG648 GGGTCCCA     PPDB MotifGGGACCC  PLACE Motif 
 OsREG650  GGTCCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG651   GTCCCACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG527     CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGCGCACGCG-3115625631156263-400-407
 OsREG555CGCACGCG PPDB Motif  PLACE Motif 
REGATCCAACGG-3115627831156286-422-430
 OsREG481ATCCAACG  PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.