version
PlantPromoterDB promoter information of J023041G06

Summary of Gene (J023041G06)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0415600        NCBI 
Gene model J023041G06  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 20329167-20327968)

Genome position     
from initiation codon
AK065818            
AK120971            
J013042K21          
J013114E15          
J013131H02          
J100037M21          
TSS from cDNA
TSS information
J023041G06                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023041G06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-20328330-163

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxAGCTATAA-2032836520328372-198-205
Y PatchCCCCTCCCC-2032831220328320-145-153
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGTCGGATC-2032839620328405-229-238
 OsREG546CCGTCGGA   PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG483 CGTCGGAT  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG588  GTCGGATC PPDB MotifCCGAC  PLACE Motif 
REGTGCGGCCCAGG-2032842920328439-262-272
 OsREG643TGCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG618 GCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG550   GGCCCAGG PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCT-2032846420328471-297-304
 OsREG461TGTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCAAAA-2032847720328487-310-320
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592   GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGGTGGCCCACAAACTGGGCCCT-2032852220328542-355-375
 OsREG653GTGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC             PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA            PPDB MotifGCCCA  PLACE Motif 
 OsREG597   GCCCACAA           PPDB MotifGCCCA  PLACE Motif 
 OsREG425          AACTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG454           ACTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG579            CTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475             TGGGCCCT PPDB MotifGCCCA  PLACE Motif 
REGTTGTGGGC-2032855020328557-383-390
 OsREG597TTGTGGGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.