version
PlantPromoterDB promoter information of J023050M06

Summary of Gene (J023050M06)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0788800        NCBI 
Gene model J023050M06  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 33638462-33637263)

Genome position     
from initiation codon
AK071670            
J013090J22          
J023073A12          
J023075P21          
J023106F04          
J075181H19          
J090009C24          
J100027L24          
J100055F06          
J100081C22          
J100084I21          
TSS from cDNA
TSS information
J023050M06                       5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023050M06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-33638015-553

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCCCACAC-3363806533638074-603-612
 OsREG613GCCCCCAC   PPDB Motif  PLACE Motif 
 OsREG535  CCCCACAC PPDB Motif  PLACE Motif 
REGCCCACTCC-3363811833638125-656-663
 OsREG532CCCACTCC PPDB MotifGCCCA  PLACE Motif 
REGGTGGGGCCCACGC-3363814933638161-687-699
 OsREG631GTGGGGCC      PPDB Motif  PLACE Motif 
 OsREG641 TGGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647  GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571    GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG602     GCCCACGC PPDB MotifGCCCA  PLACE Motif 
REGCAGGTGGGCCCC-3363817333638184-711-722
 OsREG514CAGGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG476 AGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC PPDB MotifGCCCA  PLACE Motif 
REGCACGTCTC-3363819033638197-728-735
 OsREG506CACGTCTC PPDB MotifACGT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.