version
PlantPromoterDB promoter information of J023059M19

Summary of Gene (J023059M19)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0447400        NCBI 
Gene model J023059M19  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 22715846-22714647)

Genome position     
from initiation codon
AK070858            
J023002M09          
J023003G16          
J023006F16          
J023008D10          
J023010A01          
J023012M16          
J023023H17          
J023029B12          
J023030F09          
J023034K03          
J023045A16          
J023048I04          
J023056C09          
J023056F05          
J023058B21          
J023058N06          
J023059F03          
J023060P05          
J023062D07          
J023063F16          
J023068K15          
J023069L04          
J023075I24          
J023086H01          
J023086I24          
J023091M08          
J023095A07          
J023110K06          
J023113D07          
J023126J05          
J023140F04          
J023141N19          
TSS from cDNA
TSS information
J023059M19                       5'->3' (-)
Promoter sequence










 
015-011-E01         
AK064090            
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023059M19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-22714961-115

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTCCTATAAAA-2271498622714996-140-150
Y PatchTCCCCTCTCCT-2271494122714951-95-105
Y PatchTCTCCTCCT-2271499222715000-146-154
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCCCACCACGTCGCGCGC-2271500922715028-163-182
 OsREG613GCCCCCAC             PPDB Motif  PLACE Motif 
 OsREG527   CCCACCAC          PPDB MotifGCCCA  PLACE Motif 
 OsREG557           GTCGCGCG  PPDB MotifACGCGC  PLACE Motif 
 OsREG617            TCGCGCGC PPDB Motif  PLACE Motif 
REGCACGTCACC-2271512322715131-277-285
 OsREG505CACGTCAC  PPDB MotifACGT  PLACE MotifTGAC 
 OsREG447 ACGTCACC PPDB MotifACGT  PLACE MotifTGAC 
REGCGTGTGGC-2271517122715178-325-332
 OsREG573CGTGTGGC PPDB Motif  PLACE Motif 
REGCTTGGGCTTTTATATGGGCCGGT-2271520822715230-362-384
 OsREG459CTTGGGCT                PPDB MotifGCCCA  PLACE Motif 
 OsREG426 TTGGGCTT               PPDB MotifGCCCA  PLACE Motif 
 OsREG421  TGGGCTTT              PPDB MotifGCCCA  PLACE Motif 
 OsREG419   GGGCTTTT             PPDB MotifGCCCA  PLACE Motif 
 OsREG480           ATATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG630            TATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490             ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542              TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG440               GGGCCGGT PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
REGATCTGGGC-2271524822715255-402-409
 OsREG486ATCTGGGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakCclone+22715251AK064090, AK064090

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCATATAAAAG+2271521422715224AK064090
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGCGCGCGACGTGGTGGGGGC+2271500922715028AK064090
 OsREG617GCGCGCGA             PPDB Motif  PLACE Motif 
 OsREG557 CGCGCGAC            PPDB MotifACGCGC  PLACE Motif 
 OsREG527         GTGGTGGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG613            GTGGGGGC PPDB Motif  PLACE Motif 
REGGGTGACGTG+2271512322715131AK064090
 OsREG447GGTGACGT  PPDB MotifACGT  PLACE MotifTGAC 
 OsREG505 GTGACGTG PPDB MotifACGT  PLACE MotifTGAC 
REGGCCACACG+2271517122715178AK064090
 OsREG573GCCACACG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.