version
PlantPromoterDB promoter information of J023075P20

Summary of Gene (J023075P20)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0567500        NCBI 
Gene model J023075P20  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 28339296-28338097)

Genome position     
from initiation codon
AK073046            
AK121133            
TSS from cDNA
TSS information
J023075P20                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023075P20

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-28338337-41
TSS clone peakGclone-28338336-40

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAATGGGCCTC-2833838328338393-87-97
 OsREG422AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGCGGGTGGGCCCACGCG-2833840028338415-104-119
 OsREG528CGGGTGGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG600 GGGTGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571      GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG602       GCCCACGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG530        CCCACGCG PPDB MotifGCCCA  PLACE Motif 
REGTTATGGGCCCAGATCACGGCCCG-2833843028338452-134-156
 OsREG605TTATGGGC                PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG579    GGGCCCAG            PPDB MotifGCCCA  PLACE Motif 
 OsREG629     GGCCCAGA           PPDB MotifGCCCA  PLACE Motif 
 OsREG486      GCCCAGAT          PPDB MotifGCCCA  PLACE Motif 
 OsREG504              CACGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG446               ACGGCCCG PPDB MotifACGGGC  PLACE Motif 
REGCGGGCCGTTG-2833846328338472-167-176
 OsREG446CGGGCCGT   PPDB MotifACGGGC  PLACE Motif 
 OsREG423 GGGCCGTT  PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG494  GGCCGTTG PPDB MotifCCAACGG  PLACE Motif 
REGAGTGACAC-2833851428338521-218-225
 OsREG477AGTGACAC PPDB Motif  PLACE MotifTGAC 
REGGGACCCAC-2833852728338534-231-238
 OsREG622GGACCCAC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.