version
PlantPromoterDB promoter information of J023079A11

Summary of Gene (J023079A11)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0974200        NCBI 
Gene model J023079A11  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 44841101-44842300)

Genome position     
from initiation codon
003-131-G05         
009-056-A07         
009-084-A06         
009-118-C05         
009-138-C12         
009-163-F05         
009-175-F12         
009-192-F01         
AB002820            
AF017365            
AK059392            
AK062796            
AK071182            
AK104075            
J023082P21          
J023084P04          
J065060A20          
J065065L16          
J065086F04          
J065103H07          
J065104O09          
J065108C08          
J065121B18          
J065213D20          
J075005A13          
J075012P06          
J075097C23          
J075105E16          
J075114O15          
J075120G07          
J075177K02          
J080002D04          
J080013A10          
J080023H15          
J080025I06          
J080028G07          
J080028P13          
J080029E04          
J080030B21          
J080034N04          
J080036A19          
J080036F12          
J080036P20          
J080042M13          
J080043N01          
J080049M13          
J080059A01          
J080059I24          
J080059J18          
J080066D21          
J080077B12          
J080079I11          
J080083M24          
J080083P12          
J080087D01          
J080092I01          
J080310J19          
J080315B15          
J090075D21          
J100027F23          
J100031B07          
J100034A13          
J100041O19          
J100045A01          
J100065I02          
J100069G24          
J100072E11          
J100082O08          
TSS from cDNA
TSS information
J023079A11                       5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023079A11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+44842010-91
TSS clone peakAclone+44842075-26

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGGCTATAAATA+4484197144841981-130-120
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCATCCA+4484179844841805-303-296
 OsREG534CCCATCCA PPDB MotifGCCCA  PLACE Motif 
REGCTCGCGCG+4484191444841921-187-180
 OsREG558CTCGCGCG PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+44842193AK059392

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.