version
PlantPromoterDB promoter information of J023082N10

Summary of Gene (J023082N10)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0167500        NCBI 
Gene model J023082N10  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 3947167-3948366)

Genome position     
from initiation codon
006-063-D04         
006-066-G09         
AK061061            
AK071197            
TSS from cDNA
TSS information
J023082N10                       5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023082N10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+3948087-80

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCTTCCTC+39481143948125-53-42
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCTGAGC+39478843947891-283-276
 OsREG470AGCTGAGC PPDB Motif  PLACE Motif 
REGAATTGGGCCGCA+39478983947909-269-258
 OsREG433AATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG618   TGGGCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG643    GGGCCGCA PPDB MotifGCCCA  PLACE Motif 
REGTCATGGGCCGGGCCGGG+39479143947930-253-237
 OsREG609TCATGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC         PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490  ATGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGGCCGGG PPDB MotifGCCCA  PLACE Motif 
 OsREG614     GGCCGGGC     PPDB Motif  PLACE Motif 
 OsREG616      GCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544       CCGGGCCG   PPDB Motif  PLACE Motif 
REGAAGGCCCATATGGGCCCACAA+39479403947960-227-207
 OsREG430AAGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATATGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG480   GCCCATATGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG489         ATGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640           GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627            GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG597             GCCCACAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.