version
PlantPromoterDB promoter information of J023084C08

Summary of Gene (J023084C08)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0748100        NCBI 
Gene model J023084C08  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 33074332-33073133)

Genome position     
from initiation codon
AK071261            
J043015B21          
J043039G12          
J065058A07          
J075112I15          
J075161H07          
J090015E17          
J090052H01          
J090067I17          
J090071F18          
TSS from cDNA
TSS information
J023084C08                       5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023084C08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-33073405-73

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCGTCGCGTC-3307345033073459-118-127
 OsREG556GCGTCGCG   PPDB Motif  PLACE MotifCGACG 
 OsREG583  GTCGCGTC PPDB Motif  PLACE Motif 
REGTCTGGGCCGGA-3307347233073482-140-150
 OsREG629TCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644   GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGGTGGCCCAAGCTGGGCCTA-3307349033073508-158-176
 OsREG653GTGGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TGGCCCAA           PPDB MotifGCCCA  PLACE Motif 
 OsREG581  GGCCCAAG          PPDB MotifGCCCA  PLACE Motif 
 OsREG620         GCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG473          CTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656           TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGCCAT-3307351633073526-184-194
 OsREG433AATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG487   TGGGCCAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.