version
PlantPromoterDB promoter information of J023087M20

Summary of Gene (J023087M20)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0713100        NCBI 
Gene model J023087M20  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 29606429-29607628)

Genome position     
from initiation codon
J013039M09          
J023007K01          
J023073H01          
J023133H03          
J023142E01          
J033048E03          
J033048F03          
J033058C11          
J033074M20          
J033084M11          
J033091I23          
J033100C08          
J033123K19          
J043040D10          
J090003K22          
J090006P21          
J090032M02          
J090045O16          
J090052L02          
J090059C19          
J100035H20          
J100087M13          
TSS from cDNA
TSS information
J023087M20                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023087M20

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+29607274-155

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTCCCACCAC+2960697529606985-454-444
 OsREG650GGTCCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG651 GTCCCACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG527   CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGATCCAACGGCT+2960701729607027-412-402
 OsREG481ATCCAACG    PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG518  CCAACGGC  PPDB MotifCCAACGG  PLACE Motif 
 OsREG469   CAACGGCT PPDB MotifCCAACGG  PLACE Motif 
REGCCCCCACGCCTC+2960706529607076-364-353
 OsREG536CCCCCACG     PPDB Motif  PLACE Motif 
 OsREG503    CACGCCTC PPDB Motif  PLACE Motif 
REGCCCACTCCCTGGGGCCCACCTG+2960708629607107-343-322
 OsREG532CCCACTCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG580        CTGGGGCC       PPDB Motif  PLACE Motif 
 OsREG641         TGGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647          GGGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG640           GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628            GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG476             GCCCACCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG514              CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGGGCCCCACA+2960712829607136-301-293
 OsREG631GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611 GCCCCACA PPDB Motif  PLACE Motif 
REGGGTCCACG+2960717729607184-252-245
 OsREG570GGTCCACG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.