version
PlantPromoterDB promoter information of J023088C09

Summary of Gene (J023088C09)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0646600        NCBI 
Gene model J023088C09  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 27292735-27291536)

Genome position     
from initiation codon
AB061818            
J065162G03          
TSS from cDNA
TSS information
J023088C09                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023088C09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-27291778-43

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCCTCC-2729177227291783-37-48
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGTGACAC-2729186727291874-132-139
 OsREG477AGTGACAC PPDB Motif  PLACE MotifTGAC 
REGAGGGCCCATAT-2729187827291888-143-153
 OsREG475AGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG489 GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480   GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCCCATTA-2729189427291907-159-172
 OsREG480ATATGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431     GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610      GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGCCCACTCC-2729195527291962-220-227
 OsREG532CCCACTCC PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCT-2729199627292004-261-269
 OsREG422AAATGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.