PlantPromoterDB promoter information of J023088M11

Summary of Gene (J023088M11)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0581400        NCBI 
Gene model J023088M11  
Description NONE  


Focused view (chromosome 1: 24190834-24192033)

Genome position     
from initiation codon
TSS from cDNA
TSS information
J023088M11                       5'->3' (+)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


Promoter Summary of J023088M11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakAclone+24191858AK066182, AK072015, AK066182
TSS clone peakAclone+24191871AK066182, AK072015, AK066182

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCCTCTCCCTCCTCCT+2419181024191827AK066182, AK072015
Y PatchCCTCCTCCTCCTCCTCC+2419190324191919AK066182, AK072015

REG information

TypeSequenceAnnotationGenome positionGene model
REGTCCGGCCCATAGCAGCCCATAT+2419159824191619AK066182, AK072015
 OsREG644TCCGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA            PPDB MotifGCCCA  PLACE Motif 
 OsREG591           GCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491            CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465             AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480              GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGGGGGCCCAAC+2419164924191658AK066182, AK072015
REGGGTGGGGC+2419167624191683AK066182, AK072015
REGTTCGTGGGGCCC+2419173524191746AK066182, AK072015
 OsREG572  CGTGGGGC   PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC  PPDB Motif  PLACE Motif 
REGCGCCACGTG+2419176224191770AK066182, AK072015

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.