version
PlantPromoterDB promoter information of J023088O17

Summary of Gene (J023088O17)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0701700        NCBI 
Gene model J023088O17  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 28934744-28933545)

Genome position     
from initiation codon
011-034-E06         
AF013979            
AK065161            
AK067813            
J013002C04          
J013035M07          
J013049B10          
J013065F11          
J013072K18          
J013073P08          
J013098F08          
J013154M13          
J023001H02          
J023003D16          
J023014P17          
J023036A22          
J023038N01          
J023042E11          
J023058O05          
J023084D05          
J023138O11          
J023147A10          
J033029G18          
J033031N13          
J033090D09          
J033091I06          
J033096B20          
J033101A19          
J033135D03          
J043001L13          
J043020A13          
J053071K24          
J053092L14          
J053099F19          
J065009P22          
J065046A22          
J065099K22          
J065112O22          
J065119K11          
J065212B11          
J090022A11          
J090054F15          
J090076B20          
J090099M22          
J100032L01          
J100065H13          
TSS from cDNA
TSS information
J023088O17                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023088O17

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-28934508-764
TSS clone peakGclone-28934482-738

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTCTCTCTCC-2893443428934448-690-704
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCGTGGGCCAC-2893477628934787-1032-1043
 OsREG531CCCGTGGG     PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG547 CCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571  CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654   GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653    TGGGCCAC PPDB MotifGCCCA  PLACE Motif 
REGGGTGTGTGGGCCGTGTGGC-2893478928934807-1045-1063
 OsREG499GGTGTGTG            PPDB Motif  PLACE Motif 
 OsREG598   GTGTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG627    TGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG564     GTGGGCCG       PPDB MotifGCCCA  PLACE Motif 
 OsREG445      TGGGCCGT      PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504       GGGCCGTG     PPDB MotifGCCCA  PLACE Motif 
 OsREG573           CGTGTGGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.