version
PlantPromoterDB promoter information of J023100B11

Summary of Gene (J023100B11)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0493700        NCBI 
Gene model J023100B11  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 19779657-19778458)

Genome position     
from initiation codon
009-184-A03         
011-053-H02         
015-024-E10         
015-091-G11         
AK068501            
AK099237            
AK103057            
AK105408            
J013155B08          
J023006E01          
J023060K23          
J033026L19          
J033117K03          
J033129J12          
J033149K09          
J065045I06          
J065061A10          
J065101H05          
J065135A03          
J065135F16          
J065140A21          
J065169C16          
J075018O14          
J075033C15          
J075100H13          
J075137E24          
J075142J12          
J075153F11          
J075165B04          
J100047C11          
J100047K07          
TSS from cDNA
TSS information
J023100B11                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023100B11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-19778744-87

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTCC-1977878619778794-129-137
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCACCCTCATGGGCCCAGATGTCAGTGACAC-1977880219778835-145-178
 OsREG462AGCCCACC                           PPDB MotifGCCCA  PLACE Motif 
 OsREG600 GCCCACCC                          PPDB MotifGCCCA  PLACE Motif 
 OsREG609         TCATGGGC                  PPDB MotifGCCCA  PLACE Motif 
 OsREG517          CATGGGCC                 PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG489           ATGGGCCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG579             GGGCCCAG              PPDB MotifGCCCA  PLACE Motif 
 OsREG629              GGCCCAGA             PPDB MotifGCCCA  PLACE Motif 
 OsREG486               GCCCAGAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG510                      TGTCAGTG     PPDB Motif  PLACE MotifTGAC 
 OsREG477                          AGTGACAC PPDB Motif  PLACE MotifTGAC 
REGCACTGACA-1977884119778848-184-191
 OsREG510CACTGACA PPDB Motif  PLACE MotifTGAC 
REGTAGGCCCACGC-1977890719778917-250-260
 OsREG656TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG602   GCCCACGC PPDB MotifGCCCA  PLACE Motif 
REGGCGACGCG-1977894719778954-290-297
 OsREG559GCGACGCG PPDB Motif  PLACE MotifCGACG 
REGGCGGGTCGCGCG-1977895719778968-300-311
 OsREG552GCGGGTCG     PPDB Motif  PLACE Motif 
 OsREG557    GTCGCGCG PPDB MotifACGCGC  PLACE Motif 
REGTGTGGGCCCG-1977897219778981-315-324
 OsREG627TGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG566  TGGGCCCG PPDB MotifGCCCA, ACGGGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.