version
PlantPromoterDB promoter information of J023102A14

Summary of Gene (J023102A14)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0208900        NCBI 
Gene model J023102A14  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 6138452-6139651)

Genome position     
from initiation codon
003-126-D10         
012-059-A08         
AK066171            
AK070031            
AK121183            
J013031N09          
J013045O19          
J013055F05          
J013090H20          
J013119D17          
J013130I08          
J023038F08          
J023084M01          
J023095A16          
J023145E14          
J023150C07          
J033033E15          
J033041H19          
J033046F07          
J033050E09          
J033071K17          
J033125L06          
J043040B21          
J065086N22          
J065124G13          
J065136P10          
J065143L18          
J065167B06          
J065182G12          
J065191H21          
J065193C21          
J065195A03          
J075008M04          
J075068F07          
J075104P14          
J090025K05          
J090051G08          
J090060E23          
J100022J16          
J100028L05          
J100030A07          
J100032L23          
J100070K18          
TSS from cDNA
TSS information
J023102A14                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023102A14

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+6139127-325

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACAGCCCACGT+61389156138925-537-527
 OsREG435ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG463  AGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG449   GCCCACGT PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
REGTGTGGGCCCCACACACCCCAGGCCCCACCAAC+61389706139001-482-451
 OsREG627TGTGGGCC                         PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC                        PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC                       PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA                      PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC        GGCCCCAC     PPDB Motif  PLACE Motif 
 OsREG611     GCCCCACA                    PPDB Motif  PLACE Motif 
 OsREG535      CCCCACAC                   PPDB Motif  PLACE Motif 
 OsREG499         CACACACC                PPDB Motif  PLACE Motif 
 OsREG524                 CCAGGCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG612                     GCCCCACC    PPDB Motif  PLACE Motif 
 OsREG520                        CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGACCCCCCACG+61390706139079-382-373
 OsREG438ACCCCCCA   PPDB Motif  PLACE Motif 
 OsREG536  CCCCCACG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.