PlantPromoterDB promoter information of J023105J21

Summary of Gene (J023105J21)

Organism	Oryza sativa
Chromosome	9
Locus	Os09g0516600 NCBI
Gene model	J023105J21
Description	NONE

#

Overview

Focused view (chromosome 9: 20782276-20781077)

`Genome position from initiation codon` AK072458 J023121E21 J075080H01 J075082K02 J075142H01 J100078A03 J100085B02 TSS from cDNA TSS information J023105J21 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023105J21

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG AGGTGGGCCCCACGGCCCG - 20781118 20781136 AK070780, AK103563, AY054407, J013058P06, J013093G04, J023007G05, J023091A08, J023136K23, J023138D20, J033022N20, J033065N15, J033109L23, J053073C08, J075094J24, J075106P21

OsREG476 AGGTGGGC            PPDB Motif GCCCA PLACE Motif

OsREG628 GGTGGGCC           PPDB Motif GCCCA PLACE Motif

OsREG640   GTGGGCCC          PPDB Motif GCCCA PLACE Motif

OsREG647    TGGGCCCC         PPDB Motif GCCCA PLACE Motif

OsREG641     GGGCCCCA        PPDB Motif GCCCA PLACE Motif

OsREG631      GGCCCCAC       PPDB Motif PLACE Motif

OsREG572       GCCCCACG      PPDB Motif PLACE Motif

OsREG521          CCACGGCC   PPDB Motif PLACE Motif

OsREG504           CACGGCCC PPDB Motif GCCCA PLACE Motif

OsREG446            ACGGCCCG PPDB Motif ACGGGC PLACE Motif

REG CCCGGGCCCACCAGCCCAG - 20781140 20781158 AK070780, AK103563, AY054407, J013058P06, J013093G04, J023007G05, J023091A08, J023136K23, J023138D20, J033022N20, J033065N15, J033109L23, J053073C08, J075094J24, J075106P21

OsREG539 CCCGGGCC            PPDB Motif PLACE Motif

OsREG543 CCGGGCCC           PPDB Motif GCCCA PLACE Motif

OsREG566   CGGGCCCA          PPDB Motif GCCCA, ACGGGC PLACE Motif

OsREG640    GGGCCCAC         PPDB Motif GCCCA PLACE Motif

OsREG628     GGCCCACC        PPDB Motif GCCCA PLACE Motif

OsREG599      GCCCACCA       PPDB Motif GCCCA PLACE Motif

OsREG523           CCAGCCCA PPDB Motif GCCCA PLACE Motif

OsREG512            CAGCCCAG PPDB Motif GCCCA PLACE Motif

REG GGACGGCT - 20781202 20781209 AK070780, AK103563, AY054407, J013058P06, J013093G04, J023007G05, J023091A08, J023136K23, J023138D20, J033022N20, J033065N15, J033109L23, J053073C08, J075094J24, J075106P21

OsREG468 GGACGGCT PPDB Motif PLACE Motif

REG CCCATCCA - 20781229 20781236 AK070780, AK103563, AY054407, J013058P06, J013093G04, J023007G05, J023091A08, J023136K23, J023138D20, J033022N20, J033065N15, J033109L23, J053073C08, J075094J24, J075106P21

OsREG534 CCCATCCA PPDB Motif GCCCA PLACE Motif