version
PlantPromoterDB promoter information of J023107P16

Summary of Gene (J023107P16)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0305400        NCBI 
Gene model J023107P16  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 10892368-10891169)

Genome position     
from initiation codon
009-198-D04         
013-012-C06         
014-034-D01         
AK071397            
J023012O22          
J023097A13          
J023113C14          
TSS from cDNA
TSS information
J023107P16                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023107P16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-10891448-80

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGACGCG-1089151410891521-146-153
 OsREG560GAGACGCG PPDB Motif  PLACE Motif 
REGGCCCCACC-1089154310891550-175-182
 OsREG612GCCCCACC PPDB Motif  PLACE Motif 
REGCGCACGCG-1089156810891575-200-207
 OsREG555CGCACGCG PPDB Motif  PLACE Motif 
REGCCATGGGC-1089158910891596-221-228
 OsREG525CCATGGGC PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGGGTGGGGCCCACCTGTC-1089161810891634-250-266
 OsREG612GGTGGGGC          PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC         PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC      PPDB MotifGCCCA  PLACE Motif 
 OsREG628     GGCCCACC     PPDB MotifGCCCA  PLACE Motif 
 OsREG476      GCCCACCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG514       CCCACCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG436        CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501         CACCTGTC PPDB Motif  PLACE Motif 
REGCGCCACGTGGC-1089166810891678-300-310
 OsREG448CGCCACGT    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507 GCCACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGAAGCCCATCA-1089172110891731-353-363
 OsREG582GAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466  AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607   GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGGCCCATAA-1089174110891748-373-380
 OsREG605GCCCATAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.