version
PlantPromoterDB promoter information of J023108B01

Summary of Gene (J023108B01)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0695400        NCBI 
Gene model J023108B01  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 30299137-30297938)

Genome position     
from initiation codon
015-036-B08         
AK100615            
AK106304            
TSS from cDNA
TSS information
J023108B01                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023108B01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-30298522-385
TSS clone peakGclone-30298415-278

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCCTTCCT-3029837730298388-240-251
Y PatchTTCCCCTCTCTT-3029839830298409-261-272
Y PatchTCCCCTCTCTT-3029845030298460-313-323
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCGTCGCGTCGCGTGCG-3029846330298479-326-342
 OsREG556GCGTCGCGTCGCG     PPDB Motif  PLACE MotifCGACG 
 OsREG583  GTCGCGTC        PPDB Motif  PLACE Motif 
 OsREG559    CGCGTCGC      PPDB Motif  PLACE MotifCGACG 
 OsREG555         CGCGTGCG PPDB Motif  PLACE Motif 
REGCTGGGCTTT-3029850430298512-367-375
 OsREG428CTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG421 TGGGCTTT PPDB MotifGCCCA  PLACE Motif 
REGACGTGGGCTGC-3029854130298551-404-414
 OsREG449ACGTGGGC    PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG463 CGTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG591   TGGGCTGC PPDB MotifGCCCA  PLACE Motif 
REGGGGCCGTGG-3029857630298584-439-447
 OsREG504GGGCCGTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG521 GGCCGTGG PPDB Motif  PLACE Motif 
REGCGCGTCGCGTCGC-3029863130298643-494-506
 OsREG559CGCGTCGCGTCGC PPDB Motif  PLACE MotifCGACG 
 OsREG556 GCGTCGCG     PPDB Motif  PLACE MotifCGACG 
 OsREG583   GTCGCGTC   PPDB Motif  PLACE Motif 
REGGCTGGGCTGCTGGCCCATGG-3029866830298687-531-550
 OsREG464GCTGGGCT             PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CTGGGCTG            PPDB MotifGCCCA  PLACE Motif 
 OsREG591  TGGGCTGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG577         CTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488          TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517           GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525            GCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.