version
PlantPromoterDB promoter information of J023108K23

Summary of Gene (J023108K23)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0702800        NCBI 
Gene model J023108K23  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 30546845-30548044)

Genome position     
from initiation codon
009-039-E05         
AK073948            
J033072H04          
J065008G05          
J065128J12          
J065131A01          
J065173B12          
TSS from cDNA
TSS information
J023108K23                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023108K23

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+30547441-404

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCGAGA+3054726130547268-584-577
 OsREG635GGCCGAGA PPDB Motif  PLACE Motif 
REGACATGGGCCAGGCCCAAAT+3054728030547298-565-547
 OsREG437ACATGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC           PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG488  ATGGGCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG         PPDB MotifGCCCA  PLACE Motif 
 OsREG524       CCAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG513        CAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471         AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625          GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493           GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGACAGCCCATAA+3054731230547322-533-523
 OsREG435ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465  AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605   GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGATGGCCCAGAAGGCCCACCA+3054733530547354-510-491
 OsREG487ATGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG            PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA           PPDB MotifGCCCA  PLACE Motif 
 OsREG430         AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472          AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628           GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599            GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGACATGGGCCAG+3054735630547366-489-479
 OsREG437ACATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG488  ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG PPDB MotifGCCCA  PLACE Motif 
REGGGACGGCCCATGA+3054738630547398-459-447
 OsREG624GGACGGCC      PPDB Motif  PLACE Motif 
 OsREG584 GACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445  ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490   CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517    GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609     GCCCATGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.