version
PlantPromoterDB promoter information of J023117I15

Summary of Gene (J023117I15)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0668500        NCBI 
Gene model J023117I15  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 28026098-28024899)

Genome position     
from initiation codon
006-056-A05         
AK060958            
AK071867            
J065013J03          
J065021P16          
J065044B07          
J065059E23          
J065087N20          
J065185I04          
J065190G19          
J065199C15          
J065213L12          
J080305C01          
J080308C07          
J080310F02          
TSS from cDNA
TSS information
J023117I15                       5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023117I15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-28025118-20

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCCCGCG-2802524528025252-147-154
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGCCAGCCCACGC-2802525728025267-159-169
 OsREG523CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG463  AGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG602   GCCCACGC PPDB MotifGCCCA  PLACE Motif 
REGCCAACGGCCCAGG-2802527028025282-172-184
 OsREG518CCAACGGC      PPDB MotifCCAACGG  PLACE Motif 
 OsREG494 CAACGGCC     PPDB MotifCCAACGG  PLACE Motif 
 OsREG423  AACGGCCC    PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG445   ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565    CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG550     GGCCCAGG PPDB MotifGCCCA  PLACE Motif 
REGGCCCACGCGTCC-2802530228025313-204-215
 OsREG602GCCCACGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG530 CCCACGCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG443  CCACGCGT   PPDB Motif  PLACE Motif 
 OsREG442    ACGCGTCC PPDB Motif  PLACE Motif 
REGCATCCCCC-2802534728025354-249-256
 OsREG516CATCCCCC PPDB Motif  PLACE Motif 
REGGCCCATCC-2802539428025401-296-303
 OsREG608GCCCATCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.