version
PlantPromoterDB promoter information of J023119O12

Summary of Gene (J023119O12)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0185300        NCBI 
Gene model J023119O12  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 4526309-4527508)

Genome position     
from initiation codon
011-055-A05         
015-007-B11         
015-062-F05         
015-078-C11         
016-068-F07         
016-074-F08         
AK065131            
AK098922            
J013000G12          
J013001P14          
J013002O23          
J013096L23          
J013097F24          
J013120N24          
J023007C15          
J033039O11          
J033043L11          
J033061A07          
J033076M13          
J033082B04          
J033143H15          
J043013A02          
J043036N21          
J065013M09          
J065082E22          
J065093G01          
J065120L06          
J065135D03          
J065197C10          
J100024J10          
J100042M22          
J100077E12          
J100084P03          
TSS from cDNA
TSS information
J023119O12                       5'->3' (+)
Promoter sequence










 
AK107836            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023119O12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+4527237-72

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCGTTG+45271144527121-195-188
 OsREG469AGCCGTTG PPDB MotifCCAACGG  PLACE Motif 
REGCGTGTGGGGCCCACGTG+45271574527173-152-136
 OsREG526CGTGTGGG          PPDB MotifGCCCA  PLACE Motif 
 OsREG535 GTGTGGGG         PPDB Motif  PLACE Motif 
 OsREG611  TGTGGGGC        PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC       PPDB Motif  PLACE Motif 
 OsREG641    TGGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647     GGGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG640      GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571       GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG449        GCCCACGT  PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG508         CCCACGTG PPDB MotifACGT  PLACE Motif 
REGGCCCAACA+45271884527195-121-114
 OsREG594GCCCAACA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.